| Basic information from miRBase |
| hairpin accession number: MI0005735 |
| Located between position 23695 and 23794 on chromosome Group2.17 strand - |
| mature miRNAs for MI0005735: |
| ame-miR-283 (MIMAT0004426): AAATATCAGCTGGTAATTCT |
| You can find this miRNA in ENTREZGENE: Mir283 (accession: 100315665) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |