| Basic information from miRBase |
| hairpin accession number: MI0005736 |
| Located between position 59468 and 59567 on chromosome Group8.25 strand - |
| mature miRNAs for MI0005736: |
| ame-miR-29b (MIMAT0004427): TAGCACCATTTGAAATCAGT |
| You can find this miRNA in ENTREZGENE: Mir29b (accession: 100315686) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |