miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0016220
Located between position 394655 and 394794 on chromosome Group4.13 strand -
mature miRNAs for MI0016220:
         ame-miR-3724 (MIMAT0018590): ATCGTGGTAAACTTTGAATATA

References
[1]Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F, Insect Mol Biol. 19:799-805(2010)., "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera"