| Basic information from miRBase |
| hairpin accession number: MI0005740 |
| Located between position 653791 and 653890 on chromosome Group3.18 strand - |
| mature miRNAs for MI0005740: |
| ame-miR-375 (MIMAT0004431): TTTGTTCGTTCGGCTCGAGTTA |
| You can find this miRNA in ENTREZGENE: Mir375 (accession: 100315687) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |