| Basic information from miRBase |
| hairpin accession number: MI0016211 |
| Located between position 437996 and 438120 on chromosome Group16.7 strand - |
| mature miRNAs for MI0016211: |
| ame-miR-3796 (MIMAT0018581): GATCCTAAGGGGAGGAGAGGATTT |
| References |
| [1]Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F, Insect Mol Biol. 19:799-805(2010)., "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" |