| Basic information from miRBase |
| hairpin accession number: MI0016212 |
| Located between position 629690 and 629827 on chromosome Group16.9 strand - |
| mature miRNAs for MI0016212: |
| ame-miR-3797 (MIMAT0018582): CAGAACTGGCTCGTATTTTATT |
| References |
| [1]Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F, Insect Mol Biol. 19:799-805(2010)., "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" |