miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001594
Located between position 487150 and 487236 on chromosome Group9.22 strand +
mature miRNAs for MI0001594:
         ame-miR-7 (MIMAT0001489): TGGAAGACTAGTGATTTTGTTGT
You can find this miRNA in ENTREZGENE: Mir7 (accession: 732510)

References
[1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome"