| Basic information from miRBase |
| hairpin accession number: MI0005742 |
| Located between position 20314 and 20413 on chromosome Group15.33 strand + |
| mature miRNAs for MI0005742: |
| ame-miR-79 (MIMAT0004433): TAAAGCTAGATTACCAAAGCA |
| You can find this miRNA in ENTREZGENE: Mir79 (accession: 100315670) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |