| Basic information from miRBase |
| hairpin accession number: MI0005754 |
| Located between position 243969 and 244068 on chromosome Group1.75 strand - |
| mature miRNAs for MI0005754: |
| ame-miR-932 (MIMAT0004444): TCAATTCCGTAGTGCATTGCAG |
| You can find this miRNA in ENTREZGENE: Mir932 (accession: 100315676) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |