miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001598
Located between position 878073 and 878157 on chromosome Group16.9 strand -
mature miRNAs for MI0001598:
         ame-miR-iab-4 (MIMAT0001493): ACGTATACTGAATGTATCCTGA
You can find this miRNA in ENTREZGENE: Miriab-4 (accession: 732514)

References
[1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome"