| Basic information from miRBase |
| hairpin accession number: MI0013356 |
| Located between position 5356 and 5426 on chromosome gb|ABLF01005214.1| strand - |
| mature miRNAs for MI0013356: |
| api-bantam (MIMAT0014130): TGAGATCATTGTGAAAGCTAATT |
| References |
| [1]Sathyamurthy G, Swamy NR, J. Comp. Intell. Bioinf. 2:109-119(2009)., "Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" |
| [2]Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S, BMC Genomics. 11:281(2010)., "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" |