| Basic information from miRBase |
| hairpin accession number: MI0008341 |
| Located between position 7674236 and 7674314 on chromosome nscaf1690 strand - |
| mature miRNAs for MI0008341: |
| bmo-miR-13a* (MIMAT0007896): CCTGTCAAAGCGGCGGTGAAA |
| bmo-miR-13a (MIMAT0007897): TATCACAGCCACTTTGATGTG |
| References |
| [1]He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori" |
| [2]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing" |