miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004974
Located between position 1271367 and 1271446 on chromosome nscaf3040 strand -
mature miRNAs for MI0004974:
         bmo-miR-14* (MIMAT0015227): CGGGGAGAGAAATCGACGAGGCT
         bmo-miR-14 (MIMAT0004196): TCAGTCTTTTTCTCTCTCCTA

References
[1]Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome"
[2]He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"
[3]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"