miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012994
Located between position 5616178 and 5616256 on chromosome nscaf2589 strand +
mature miRNAs for MI0012994:
         bmo-miR-1b* (MIMAT0013787): CCATACTTCTTTACATTCCATA
         bmo-miR-1 (MIMAT0013788): TGGGAAGTAAGGAAGCACGGAA

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"