miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004979
Located between position 1921658 and 1921743 on chromosome nscaf2993 strand +
mature miRNAs for MI0004979:
         bmo-miR-275* (MIMAT0015231): CGCGCTACTCCGGCGCCAGGACT
         bmo-miR-275 (MIMAT0004201): TCAGGTACCTGAAGTAGCGCGCG

References
[1]Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome"
[2]He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"
[3]Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[4]Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y, Insect Biochem Mol Biol. 38:1066-1071(2008)., "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
[5]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"