miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012203
Located between position 174 and 277 on chromosome scaffold16400 strand -
mature miRNAs for MI0012203:
         bmo-miR-2751 (MIMAT0012631): GTCTGGGCCGTGGAGCGTTT

References
[1]Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J, Genomics. 94:438-444(2009)., "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome"