miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012316
Located between position 993104 and 993186 on chromosome nscaf2734 strand -
mature miRNAs for MI0012316:
         bmo-miR-2762 (MIMAT0013636): GTACGTCGGGAAATGTACGGTA

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"