miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012298
Located between position 2930726 and 2930802 on chromosome nscaf2823 strand +
mature miRNAs for MI0012298:
         bmo-miR-279b* (MIMAT0013608): ATGGGTATAGGTCTAGTAT
         bmo-miR-279b (MIMAT0013609): TGACTAGATCTACACTCATTGA

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"