| Basic information from miRBase |
| hairpin accession number: MI0004984 |
| Located between position 690173 and 690255 on chromosome nscaf2891 strand - |
| mature miRNAs for MI0004984: |
| bmo-miR-283 (MIMAT0004206): TAAATATCAGCTGGTAATTCT |
| bmo-miR-283* (MIMAT0015235): CAGGCTATCAGCTGGTATACAG |
| References |
| [1]Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome" |
| [2]He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori" |
| [3]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing" |