miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004986
Located between position 4741979 and 4742074 on chromosome nscaf2828 strand -
mature miRNAs for MI0004986:
         bmo-miR-307* (MIMAT0015237): ACTCACTCAACCTGGGTGTGATG
         bmo-miR-307 (MIMAT0004208): TCACAACCTCCTTGAGTGAG

References
[1]Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome"
[2]He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"
[3]Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y, Insect Biochem Mol Biol. 38:1066-1071(2008)., "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
[4]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"