miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008349
Located between position 3834385 and 3834476 on chromosome nscaf2823 strand -
mature miRNAs for MI0008349:
         bmo-miR-317* (MIMAT0015277): CGGGTGCCACGCTGTGCTCTCT
         bmo-miR-317 (MIMAT0007906): AGTGAACACAGCTGGTGGTATC

References
[1]He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"
[2]Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[3]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"