miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012324
Located between position 2055463 and 2055541 on chromosome nscaf2970 strand +
mature miRNAs for MI0012324:
         bmo-miR-375 (MIMAT0013648): ACCCGAGCGGTCTGAGCAAACT
         bmo-miR-375* (MIMAT0013649): TTTGTTCGCCCCGGCTCGTGTCG

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"
[2]Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R, BMC Genomics. 11:52(2010)., "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development"
[3]Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J, Funct Integr Genomics. 10:405-415(2010)., "Novel microRNAs in silkworm (Bombyx mori)"