miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012310
Located between position 7903245 and 7903323 on chromosome nscaf3058 strand +
mature miRNAs for MI0012310:
         bmo-miR-745* (MIMAT0013625): CGGCTCATCGTGTGGCAGTTTGCT
         bmo-miR-745 (MIMAT0013626): CAGCTGCCTAGCGAAGGGCAACG

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"