| Basic information from miRBase |
| hairpin accession number: MI0010003 |
| Located between position 7595334 and 7595422 on chromosome nscaf2847 strand + |
| mature miRNAs for MI0010003: |
| bmo-miR-932 (MIMAT0009160): TCAATTCCGTAGTGCATTGCAG |
| References |
| [1]Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" |
| [2]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing" |