| Basic information from miRBase |
| hairpin accession number: MI0012205 |
| Located between position 425 and 515 on chromosome scaffold4254 strand + |
| mature miRNAs for MI0012205: |
| bmo-miR-989 (MIMAT0012633): GTGTGATGTGACGTAGTGGAA |
| References |
| [1]Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J, Genomics. 94:438-444(2009)., "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" |
| [2]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing" |
| [3]Huang Y, Zou Q, Tang SM, Wang LG, Shen XJ, Mol Biol Rep. 37:3171-3176(2010)., "Computational identification and characteristics of novel microRNAs from the silkworm (Bombyx mori L.)" |