miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012193
Located between position 28891 and 28998 on chromosome nscaf2839 strand +
mature miRNAs for MI0012193:
         bmo-miR-9c* (MIMAT0015302): TCTTTGGTATCCTAGCTG
         bmo-miR-9c (MIMAT0012621): TAAAGTTATGGTACCGAAGTTA

References
[1]Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J, Genomics. 94:438-444(2009)., "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome"
[2]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"