| Basic information from miRBase |
| hairpin accession number: MI0014235 |
| Located between position 47730199 and 47730278 on chromosome 19 strand + |
| Overlapping with antisense strand of BBC3-203 (intron 2). |
| (Ensemble: ENST00000439096) |
| mature miRNAs for MI0014235: |
| hsa-miR-3190 (MIMAT0015073): TGTGGAAGGTAGACGGCCAGAGA |
| You can find this miRNA in ENTREZGENE: MIR3190 (accession: 100422899) |
| References |
| [1]Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK, PLoS One. 5:e9685(2010)., "Characterization of the Melanoma miRNAome by Deep Sequencing" |