Basic information from miRBase |
hairpin accession number: MI0008324 |
Located between position 12101247 and 12101329 on chromosome 15 strand + |
Overlapping with sense strand of Zfr-001 (intron 16). |
(Ensemble: OTTMUST00000083191) |
mature miRNAs for MI0008324: |
mmu-miR-1898 (MIMAT0007875): AGGTCAAGGTTCACAGGGGATC |
You can find this miRNA in MGI: Mir1898 (accession: 3811421) |
References |
[1]He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R, BMC Genomics. 9:236(2008)., "MicroRNA-encoding long non-coding RNAs" ![]() |