miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004645
Located between position 113826191 and 113826299 on chromosome 13 strand +
Overlapping with sense strand of Cdc20b-201 (intron 2).
(Ensemble: ENSMUST00000109244)
mature miRNAs for MI0004645:
         mmu-miR-449c (MIMAT0003460): AGGCAGTGCATTGCTAGCTGG
You can find this miRNA in MGI: Mir449c (accession: 3639505)

References
[1]Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"
[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"