| Basic information from miRBase |
| hairpin accession number: MI0018034 |
| Located between position 40797089 and 40797171 on chromosome 4 strand - |
| Overlapping with sense strand of B4galt1-002 (intron 1). |
| (Ensemble: OTTMUST00000015076) |
| mature miRNAs for MI0018034: |
| mmu-miR-5123 (MIMAT0020633): TGTAGATCCATATGCCATGGTGTG |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |