| Basic information from miRBase |
| hairpin accession number: MI0010543 |
| Located between position 32818350 and 32818603 on chromosome MtChr7 strand + |
| mature miRNAs for MI0010543: |
| mtr-miR1509 (MIMAT0010034): TTAATCTAGGAAAATACGGTG |
| mtr-miR1509* (MIMAT0010035): ACCGGATTTCCTTGATTAAAG |
| References |
| [1]Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T, BMC Genomics. 9:593(2008)., "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" |