| Basic information from miRBase |
| hairpin accession number: MI0010540 |
| Located between position 19401653 and 19401888 on chromosome MtChr5 strand + |
| mature miRNAs for MI0010540: |
| mtr-miR1510b* (MIMAT0010028): CCATGGATCCCTACCATGTGG |
| mtr-miR1510b (MIMAT0010029): ACATGGTCGGTATCCCTGGAA |
| References |
| [1]Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T, BMC Genomics. 9:593(2008)., "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" |