| Basic information from miRBase |
| hairpin accession number: MI0010539 |
| Located between position 28613937 and 28614038 on chromosome MtChr2 strand - |
| mature miRNAs for MI0010539: |
| mtr-miR2086* (MIMAT0010026): CCAGTTCTGCGTTCATGTCCC |
| mtr-miR2086 (MIMAT0010027): GACATGAATGCAGAACTGGAA |
| References |
| [1]Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T, BMC Genomics. 9:593(2008)., "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" |
| [2]Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M, Plant Cell. 21:2780-2796(2009)., "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" |