miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010545
Located between position 14739687 and 14739832 on chromosome MtChr8 strand +
mature miRNAs for MI0010545:
         mtr-miR2088a (MIMAT0010038): AGGCCTAGATTACATTGGAC
         mtr-miR2088a* (MIMAT0010039): TCCAATGTAATCTAGGTCTA

References
[1]Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T, BMC Genomics. 9:593(2008)., "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families"
[2]Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M, Plant Cell. 21:2780-2796(2009)., "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules"