| Basic information from miRBase |
| hairpin accession number: MI0005071 |
| Located between position 16923957 and 16924051 on chromosome MtChr5 strand - |
| mature miRNAs for MI0005071: |
| mtr-miR395d (MIMAT0003857): ATGAAGTGTTTGGGGGAACTC |
| References |
| [1]Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L, Cell Res. 15:631-638(2005)., "Molecular evolution of the rice miR395 gene family" |