Basic information from miRBase |
hairpin accession number: MI0005075 |
Located between position 16949547 and 16949647 on chromosome MtChr5 strand - |
mature miRNAs for MI0005075: |
mtr-miR395h (MIMAT0003861): ATGAAGTGTTTGGGGGAACTT |
References |
[1]Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L, Cell Res. 15:631-638(2005)., "Molecular evolution of the rice miR395 gene family" |