| Basic information from miRBase |
| hairpin accession number: MI0002236 |
| Located between position 3064788 and 3064883 on chromosome scaffold_2 strand - |
| mature miRNAs for MI0002236: |
| ptc-miR167b (MIMAT0001942): TGAAGCTGCCAGCATGATCTA |
| References |
| [1]Dezulian T, Palatnik JF, Huson DH, Weigel D, http://genomebiology.com/2005/6/11/p13 (2005)., "Conservation and divergence of microRNA families in plants" |
| [2]Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm, Science. 313:1596-1604(2006)., "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" |