| Basic information from miRBase |
| hairpin accession number: MI0008461 |
| Located between position 21117233 and 21117350 on chromosome 1 strand - |
| Overlapping with sense strand of (intron 4). |
| (Ensemble: ENSPTRT00000059535) |
| mature miRNAs for MI0008461: |
| ptr-miR-1256 (MIMAT0007981): AGGCATTGACTTCTCACTAGCT |
| You can find this miRNA in ENTREZGENE: MIR1256 (accession: 100316065) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |