miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008461
Located between position 21117233 and 21117350 on chromosome 1 strand -
Overlapping with sense strand of (intron 4).
(Ensemble: ENSPTRT00000059535)
mature miRNAs for MI0008461:
         ptr-miR-1256 (MIMAT0007981): AGGCATTGACTTCTCACTAGCT
You can find this miRNA in ENTREZGENE: MIR1256 (accession: 100316065)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"