| Basic information from miRBase |
| hairpin accession number: MI0008466 |
| Located between position 69391725 and 69391816 on chromosome 1 strand - |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSPTRT00000059103) |
| mature miRNAs for MI0008466: |
| ptr-miR-1262 (MIMAT0007986): ATGGGTGAATTTGTAGAAGGAT |
| You can find this miRNA in ENTREZGENE: MIR1262 (accession: 100316313) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |