miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: similar mature miRNAs




mature miRNA sequence:

CTAATGTGTTGTCTTTGTTAG

    similar mature miRNA(s)
   GTAATGTGTTGTGTTTGTTAG
    vvi-miR235a (PMRD)
    vvi-miR235b (PMRD)

   TTAATGTGTTGTGTTTGTGAG
    gma-miR2108b, MIMAT0010085 (miRBase)
    gma-miR2108b (PMRD)

   TTAATGTGTTGTGTTTGTCGG
    gma-miR2108a, MIMAT0010084 (miRBase)
    gma-miR2108a (PMRD)