miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: similar mature miRNAs




mature miRNA sequence:

TCCGGAGGGATGCCTTCCTTA

    similar mature miRNA(s)
   TCCGGAGGGATTCCTTCCTT
    ath-miRf10060-akr (PMRD)