miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: similar mature miRNAs




mature miRNA sequence:

TGTGCGTGTGTGCATGTGTGT

    similar mature miRNA(s)
   TGTGGGTGTGTGCATGTGCGTG
    bta-miR-669, MIMAT0013838 (miRBase)

   TGTGTGTGTGTGTGTGTGTG
    mmu-miR-466i-5p, MIMAT0017325 (miRBase)

   TGTGTGCATGTGCATGTGTGTAT
    mmu-miR-669m-5p, MIMAT0017346 (miRBase)
    mmu-miR-466m-5p, MIMAT0014882 (miRBase)