Detailed information on CNT0000393 (Glycine max)


BLAST search results

BLAST vs PNRD: nothing found

BLAST vs Swiss-Prot:
sp|Q9LS94|RAG3F_ARATH, E-value = 1e-10

BLAST vs NONCODE (A. thaliana): nothing found

Potential orthologs
: nothing found

Most similar lncRNAs
: nothing found

Expression of CNT0000393

Created with Highcharts 4.1.6Chart context menuExpression (RPKM)0.990.3971.21801.8891.1862.3210.87100.7761.6881.383000.549leaves (SRR924099)leaves (SRR924144)leaves (SRR926169)seed (SRR639168)shoot apical meristem (SRR824155)shoot apical meristem (SRR824156)shoot apical meristem (SRR824157)shoot apical meristem (SRR824158)shoot apical meristem (SRR824159)shoot apical meristem (SRR824160)shoot apical meristem (SRR824161)shoot apical meristem (SRR824162)shoot apical meristem (SRR824163)whole seed (SRR639162)whole seed (SRR639164)00.20.40.60.811.21.41.61.822.22.42.6

Sequence

>CNT0000393
CTATCTTCAAATTGCACTTCTTTGGTTAAAAAATCCGCTCCAATGGTTGCCTTGTACTGATTACTAAACTTCTTATTCACATACCTAAATTACATATGTT
AGGGGAAAATACATAGTTTACATGCAGTACTAAACAATAGAAAGCAAATTGCATCGCAAAGTAAAGAACACGGAGTATGTAGACAGAAACAGAAGGATAC
TGGTTCATCAAAGACGTCTTCCCCACCCTGCGAAACATCAACAACAAAATTACATAATGTCCTCAAAAGGAAGAAAAAAGAACCGATGGAAACAGAAAAT

lncRNA-RNA interactions

Number of interactions: 5

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
GLYMA11G12630.1 Uncharacterized protein protein coding CNT0000393 455 266 CDS Trans
GLYMA11G12630.2 Uncharacterized protein protein coding CNT0000393 455 266 CDS Trans
GLYMA11G12630.3 Uncharacterized protein protein coding CNT0000393 455 266 CDS Trans
GLYMA11G12630.4 Uncharacterized protein protein coding CNT0000393 455 266 CDS Trans
GLYMA12G04830.1 Uncharacterized protein protein coding CNT0000393 812 300 CDS Cis