Detailed information on CNT0001074 (Glycine max)


BLAST search results

BLAST vs PNRD: nothing found

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE (A. thaliana): nothing found

Potential orthologs
: nothing found

Most similar lncRNAs
: nothing found

Expression of CNT0001074

Created with Highcharts 4.1.6Chart context menuExpression (RPKM)5.2595.6276.46801.6720.5250.8221.1560.8591.7161.8673.2631.05700.486leaves (SRR924099)leaves (SRR924144)leaves (SRR926169)seed (SRR639168)shoot apical meristem (SRR824155)shoot apical meristem (SRR824156)shoot apical meristem (SRR824157)shoot apical meristem (SRR824158)shoot apical meristem (SRR824159)shoot apical meristem (SRR824160)shoot apical meristem (SRR824161)shoot apical meristem (SRR824162)shoot apical meristem (SRR824163)whole seed (SRR639162)whole seed (SRR639164)00.511.522.533.544.555.566.57

Sequence

>CNT0001074
TCTGGTCTTTCAACATGAGGAAGGTGACCACAATCGGGTATTTGGCGTATAATGGCATCAGCTAATTCACAATGCAGTCGCTGAAAGAGTAAAAGTTCAC
AAGTCAACTGCACTCATAGTATTAGCAGGCAATATAGTCTCCTAGCAGTCAAATAACAGAAATAAAGAGAATTATATTTCAAAACCAAGATTTTCCAGCA
TGTCGTGTAATATCTTTTGTGTTCATCATCATGTCATAGACAAGTAGAGTGCTATGTACTAACTAACCACTGCAAGCTTATTGCTGATTATGCGATCATT
CTCTCCCCAAATGATGAGAGTTTTCTGCTTTACCTGTTA

lncRNA-RNA interactions

Number of interactions: 4

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
GLYMA01G07110.1 Uncharacterized protein protein coding CNT0001074 180 216 CDS Trans
GLYMA07G35223.1 Uncharacterized protein protein coding CNT0001074 343 134 CDS Trans
GLYMA20G03090.2 Uncharacterized protein protein coding CNT0001074 934 339 CDS Cis
GLYMA20G03090.3 Uncharacterized protein protein coding CNT0001074 934 339 UTR3 Cis