Detailed information on CNT0001322 (Glycine max)


BLAST search results

BLAST vs PNRD: nothing found

BLAST vs Swiss-Prot:
sp|F4IPE3|IDD15_ARATH, E-value = 2e-07

BLAST vs NONCODE (A. thaliana): nothing found

Potential orthologs: nothing found

Most similar lncRNAs: nothing found

Expression of CNT0001322

Created with Highcharts 4.1.6Chart context menuExpression (RPKM)00000.4840000.4970.3970.86400.4082.7821.125leaves (SRR924099)leaves (SRR924144)leaves (SRR926169)seed (SRR639168)shoot apical meristem (SRR824155)shoot apical meristem (SRR824156)shoot apical meristem (SRR824157)shoot apical meristem (SRR824158)shoot apical meristem (SRR824159)shoot apical meristem (SRR824160)shoot apical meristem (SRR824161)shoot apical meristem (SRR824162)shoot apical meristem (SRR824163)whole seed (SRR639162)whole seed (SRR639164)00.20.40.60.811.21.41.61.822.22.42.62.83

Sequence

>CNT0001322
GGACAGTGCATGCATCTTGGTGTTCTATGAAACTCTCCACCCTGAAAAGGACAAACGTTTAGGGGGCTGAATCTGAGGAGCAAAAAAAAAACACAAAAAC
CAAGAAAGAGAGAGAAAGGTGTGAACTTGGAATAATGGACAAGAAACACCACACGCAGGTGTATGTGTGAGAACTGAGAAGCGGGGATTATTAAGAGGGA
AAAGAAAACAAAATACAAAGAAAGTAATTAACCTGGAAAAGACACGGCCACAGTCACAGGAATGGCCCCTGGTGCCACAGGTTTTGATGTGAG

lncRNA-RNA interactions

Number of interactions: 4

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
GLYMA05G26780.2 Uncharacterized protein protein coding CNT0001322 213 236 CDS Trans
GLYMA05G26780.2 Uncharacterized protein protein coding CNT0001322 166 63 CDS Trans
GLYMA08G09760.1 Uncharacterized protein protein coding CNT0001322 667 234 CDS Cis
GLYMA08G09760.1 Uncharacterized protein protein coding CNT0001322 184 63 CDS Cis