Detailed information on CNT0001526 (Glycine max)


BLAST search results

BLAST vs PNRD: nothing found

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE (A. thaliana): nothing found

Potential orthologs: nothing found

Most similar lncRNAs: nothing found

Expression of CNT0001526

Created with Highcharts 4.1.6Chart context menuExpression (RPKM)2.661.5240.62300.36200000.5950001.0420leaves (SRR924099)leaves (SRR924144)leaves (SRR926169)seed (SRR639168)shoot apical meristem (SRR824155)shoot apical meristem (SRR824156)shoot apical meristem (SRR824157)shoot apical meristem (SRR824158)shoot apical meristem (SRR824159)shoot apical meristem (SRR824160)shoot apical meristem (SRR824161)shoot apical meristem (SRR824162)shoot apical meristem (SRR824163)whole seed (SRR639162)whole seed (SRR639164)00.20.40.60.811.21.41.61.822.22.42.62.8

Peptides detected in this lncRNA

>peptide 1 (30 aa)
SSFTLFIIEIISCMKSQKSCSLKKKHFFFL*

>peptide 2 (38 aa)
LVFHIVHHRDHLLHEVTKILLIKKKTFFFLIKIVIEKK*

Sequence

>CNT0001526
CTCGTCTTTCACATTGTTCATCATCGAGATCATCTCTTGCATGAAGTCACAAAAATCCTGCTCATTAAAAAAAAAACATTTTTTTTTCTTATAAAAATAG
TAATTGAAAAAAAATGAAAGGAAAAAACTTTACGGACTTGGTCTTCTTCCTCCAAAGGATCGTAGAGCCCCGCATCGTACATTGACCTTTTAGACTGATC
GGAGAGAACTGTTACCCAATCGAAAACATCACTACTAATTAATCAAATTTTGCAGCAATTAAAACAATACTAATTAAAGTGATGATGCAATTTGCAAGGT
AACCTGAGTAGGCTTCTTGGATTTGCTGAAACCGGCGCTTGGCTTCGCCGGCGGTTGCGGGATTCAGAGCCCACTTGTCCGGGTGCCACCT

lncRNA-RNA interactions

Number of interactions: 5

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
GLYMA03G39200.1 Uncharacterized protein protein coding CNT0001526 1090 391 CDS Cis
GLYMA03G39200.2 Uncharacterized protein protein coding CNT0001526 1090 391 CDS_UTR Cis
GLYMA19G41760.1 Uncharacterized protein protein coding CNT0001526 792 405 CDS Trans
GLYMA19G41760.2 Uncharacterized protein protein coding CNT0001526 792 405 CDS_UTR Trans
GLYMA19G41760.3 Uncharacterized protein protein coding CNT0001526 792 405 CDS Trans