RetrogeneDB ID: | retro_acar_80 | ||
Retrocopy location | Organism: | Anole lizard (Anolis carolinensis) | |
| Coordinates: | 2:49129024..49129302(+) | ||
| Located in intron of: | None | ||
Retrocopy information | Ensembl ID: | None | |
| Aliases: | None | ||
| Status: | NOVEL | ||
Parental gene information | Parental gene summary: | ||
| Parental gene symbol: | FABP1 | ||
| Ensembl ID: | ENSACAG00000008459 | ||
| Aliases: | None | ||
| Description: | None |
Retrocopy-Parental alignment summary:
>retro_acar_80
GTCCGATGCCATGAAAATTGGAGCCATTCATGAAGGCAATTGGACTTTCTGATGAGTTGATTGAAAAAGGCAAGGATGTG
AAAAGCATCTCTAAATTGTACAGGATGGTAAGTTCAAAGTCACCGTGACAACTGCTAAGAAGTGTTGATTAATGAATTTG
CAAGTGGAGGGGAGGCTGAGTTGACACTCCTATCGAAGAAAAGATCACGGGCAATGTTCAGCTAGAAGGAGACAATAAGA
TGGTTATAAAGCTGAAAGACATCACACCTGTAAGTAAG
ORF - retro_acar_80 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
| Percent Identity: | 70.71 % |
| Parental protein coverage: | 70.9 % |
| Number of stop codons detected: | 0 |
| Number of frameshifts detected: | 4 |
Retrocopy - Parental Gene Alignment:
| Parental | LQTHENF-EPFMKAIGLSDELIEKGKDVKSISE-IEQNGNKFKVTVTTGSK-VLINEFTIGEEAELT-TP |
| ...HEN..EPFMKAIGLSDELIEKGKDVKSIS..I.Q.G.KFKVTVTT..K.VLINEF..G.EAELT.TP | |
| Retrocopy | VRCHENW<EPFMKAIGLSDELIEKGKDVKSISK<IVQDG-KFKVTVTTAKK<VLINEFASGGEAELT<TP |
| Parental | TGEKMKAVVHMEGDNKMVAKLKDITSVTE |
| ..EK....V..EGDNKMV.KLKDIT.V.. | |
| Retrocopy | IEEKITGNVQLEGDNKMVIKLKDITPVSK |
Legend:
| * | Stop codon |
| > | Forward frameshift by one nucleotide |
| < | Reverse frameshift by one nucleotide |
(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)
Expression validation based on RNA-Seq data:
| Library | Retrocopy expression | Parental gene expression |
|---|---|---|
| SRP009831_adrenal | 0 .13 RPM | 0 .16 RPM |
| SRP009831_brain | 0 .24 RPM | 1 .47 RPM |
| SRP009831_dewlap | 0 .25 RPM | 627 .19 RPM |
| SRP009831_embryo | 0 .09 RPM | 3 .88 RPM |
| SRP009831_heart | 0 .16 RPM | 0 .52 RPM |
| SRP009831_liver | 0 .00 RPM | 0 .00 RPM |
| SRP009831_lung | 0 .10 RPM | 0 .76 RPM |
| SRP009831_ovary | 0 .08 RPM | 957 .95 RPM |
| SRP009831_skeletal_muscle | 0 .00 RPM | 0 .66 RPM |
Anolis carolinensis was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_acar_80 retrocopy.
Anolis carolinensis was not studied using FANTOM5 data.
retro_acar_80 was not experimentally validated.
Retrocopy orthology:
Anolis carolinensis does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.Parental genes homology:
Parental genes homology involve 1 parental gene, and 1 retrocopy.| Species | Parental gene accession | Retrocopies number | |
|---|---|---|---|
| Anolis carolinensis | ENSACAG00000008459 | 1 retrocopy |
retro_acar_80 ,
|