RetrogeneDB ID: | retro_brap_44 | ||
Retrocopy location | Organism: | Chinese cabbage (Brassica rapa) | |
| Coordinates: | A04:10380159..10380387(+) | ||
| Located in intron of: | None | ||
Retrocopy information | Ensembl ID: | None | |
| Aliases: | None | ||
| Status: | NOVEL | ||
Parental gene information | Parental gene summary: | ||
| Parental gene symbol: | None | ||
| Ensembl ID: | Bra030324 | ||
| Aliases: | None | ||
| Description: | None |
Retrocopy-Parental alignment summary:
>retro_brap_44
GGTAGAGGAGCTTATGGCGGAGGTGGAGGAGTGGATAACGTAAGTGGAACTTGTGGATGTGGATATGAAAGTTATGGTGG
TCAAAGATGTGGTTAGCCGTCATGGAAGCGGTGGTGGCAAAGGCAGCGAAGGGAGAAGAACCAGAGGTGGAGATAGATCT
ACACTTATACTCCTCGGTGGCGGTAGAGAAAGTGGCGGTGGAGAAGCTTATGGCGGAGTGGAGTTTAT
ORF - retro_brap_44 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
| Percent Identity: | 52.44 % |
| Parental protein coverage: | 64.96 % |
| Number of stop codons detected: | 0 |
| Number of frameshifts detected: | 2 |
Retrocopy - Parental Gene Alignment:
| Parental | GVGSYGGGEGGRAGRGA-VDVDQKL---EEVVSSHGAGGGSYCGSAYVGRNQRR-ERSTIIPSSGGRGSG |
| G.G.YGGG.G.....G..VDVD.K......VVS.HG.GG....G....GR..R...RST.I...GGR.SG | |
| Retrocopy | GRGAYGGGGGVDNVSGT>VDVDMKVMVVKDVVSRHGSGG----GKGSEGRRTRGGDRSTLILLGGGRESG |
| Parental | GGEAYGG-GGVY |
| GGEAYGG..GVY | |
| Retrocopy | GGEAYGG<SGVY |
Legend:
| * | Stop codon |
| > | Forward frameshift by one nucleotide |
| < | Reverse frameshift by one nucleotide |
Brassica rapa was not studied using RNA-Seq expression data.
Brassica rapa was not studied using ChIP-Seq data.
Brassica rapa was not studied using EST data.
Brassica rapa was not studied using FANTOM5 data.
retro_brap_44 was not experimentally validated.
Retrocopy orthology:
Brassica rapa does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.Parental genes homology:
Parental genes homology involve 1 parental gene, and 1 retrocopy.| Species | Parental gene accession | Retrocopies number | |
|---|---|---|---|
| Brassica rapa | Bra030324 | 1 retrocopy |
retro_brap_44 ,
|