Detailed information on CNT0000283 (Glycine max)


BLAST search results

BLAST vs PNRD: nothing found

BLAST vs Swiss-Prot:
sp|O24338|ASNS_SANAU, E-value = 2e-15

BLAST vs NONCODE (A. thaliana): nothing found

Potential orthologs
: nothing found

Most similar lncRNAs
:
CNT0004337, E-value = 2e-07 (V. vinifera)

Expression of CNT0000283

Created with Highcharts 4.1.6Chart context menuExpression (RPKM)00.5160.52700.61302.4120.56500.50400000leaves (SRR924099)leaves (SRR924144)leaves (SRR926169)seed (SRR639168)shoot apical meristem (SRR824155)shoot apical meristem (SRR824156)shoot apical meristem (SRR824157)shoot apical meristem (SRR824158)shoot apical meristem (SRR824159)shoot apical meristem (SRR824160)shoot apical meristem (SRR824161)shoot apical meristem (SRR824162)shoot apical meristem (SRR824163)whole seed (SRR639162)whole seed (SRR639164)00.20.40.60.811.21.41.61.822.22.42.6

Sequence

>CNT0000283
TCCAGGAACACTCAGCCTGGCTGAGTTCTACAAAACCAAATTAAGGGACACAGATTTTGATTAGCTCTTGTTAAATCAACATGAATTATTTTTTCATATC
TAGGCATGGTTGATTAAATTTACCTGAGGGAAGAACCTCTCAAATATCATTCTATAGTAGTATGCTTCTTTGGTGGTTGGTGTGTTGAAGGGGAAAATGT
TAGCAGCATTGAGCATCATTCTGTCAGTCAC

lncRNA-RNA interactions

Number of interactions: 6

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
GLYMA02G39320.1 Asparagine synthetase protein coding CNT0000283 106 72 CDS Trans
GLYMA02G39320.2 Asparagine synthetase protein coding CNT0000283 106 72 CDS Trans
GLYMA02G39320.3 Asparagine synthetase protein coding CNT0000283 106 72 CDS_UTR Trans
GLYMA11G27480.1 Asparagine synthetase protein coding CNT0000283 636 231 CDS Cis
GLYMA11G27720.1 Asparagine synthetase protein coding CNT0000283 633 231 CDS Trans
GLYMA14G37440.1 Asparagine synthetase protein coding CNT0000283 112 72 CDS Trans