Detailed information on CNT0001229 (Glycine max)


BLAST search results

BLAST vs PNRD: nothing found

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE (A. thaliana): nothing found

Potential orthologs
: nothing found

Most similar lncRNAs
:
CNT0005526, E-value = 2e-07 (V. vinifera)

Expression of CNT0001229

Created with Highcharts 4.1.6Chart context menuExpression (RPKM)00.50700000000.49500000leaves (SRR924099)leaves (SRR924144)leaves (SRR926169)seed (SRR639168)shoot apical meristem (SRR824155)shoot apical meristem (SRR824156)shoot apical meristem (SRR824157)shoot apical meristem (SRR824158)shoot apical meristem (SRR824159)shoot apical meristem (SRR824160)shoot apical meristem (SRR824161)shoot apical meristem (SRR824162)shoot apical meristem (SRR824163)whole seed (SRR639162)whole seed (SRR639164)00.0250.050.0750.10.1250.150.1750.20.2250.250.2750.30.3250.350.3750.40.4250.450.4750.50.5250.…0.55

Sequence

>CNT0001229
GAAACGATTCATGGGTATGCGTTCCTTTAGAAGCTCGTTTAGTGCATCCAATGATTCCTGAGTATAAGAAATACTGATTAGAGAATCAGACTATAAGTAA
AATTATACTTCATTTCCATACTGGACTGACCTGAGATAAAAGTAAGAATGGATAACCGTCAGAGAAATAGGTCCGATGCTGTCCTCGAACATAATCAGGA
TCCACTTGTCTAACTTCTGAAGCTTCATTTGGAAA

lncRNA-RNA interactions

Number of interactions: 2

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
GLYMA09G05520.1 Uncharacterized protein protein coding CNT0001229 613 224 CDS Cis
GLYMA09G05530.1 Uncharacterized protein protein coding CNT0001229 175 234 CDS Trans